JavaScript Node #1 — Fasta
Generate DNA sequences by copying from a given sequence and by weighted random selection with a simple linear congruential generator.
| Time | 10,524.1 ms |
|---|---|
| CPU time | 11,481.7 ms |
| Peak memory | 1,445,224 KB |
| gz | 820 bytes — comments removed, gzipped |
| Style | ★★★☆☆ |
| Implementation | JavaScript — JavaScript (Node.js) 24.10.0 |
| By | sysop- |
| Submitted | September 24, 2026 |
Style assessment
Clear, era-typical benchmarks-game JS: sensible function decomposition and direct wrap-around logic, but it leans on dated constructs (var everywhere, for...in over objects, per-line console.log instead of buffered process.stdout.write, new Array) and terse globals (A, C, M, last) with `last` shadowed to mean something different inside makeCumulative. Using let/const, Object.keys/entries, and chunked stdout writes would raise both idiom and naming.
Source
89 lines · Download fasta-javascript-node-1.js
// The Computer Language Benchmarks Game
// http://benchmarksgame.alioth.debian.org/
//
// Contributed by Ian Osgood
var last = 42, A = 3877, C = 29573, M = 139968;
function rand(max) {
last = (last * A + C) % M;
return max * last / M;
}
var ALU =
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
var IUB = {
a:0.27, c:0.12, g:0.12, t:0.27,
B:0.02, D:0.02, H:0.02, K:0.02,
M:0.02, N:0.02, R:0.02, S:0.02,
V:0.02, W:0.02, Y:0.02
}
var HomoSap = {
a: 0.3029549426680,
c: 0.1979883004921,
g: 0.1975473066391,
t: 0.3015094502008
}
function makeCumulative(table) {
var last = null;
for (var c in table) {
if (last) table[c] += table[last];
last = c;
}
}
function fastaRepeat(n, seq) {
var seqi = 0, lenOut = 60;
while (n>0) {
if (n<lenOut) lenOut = n;
if (seqi + lenOut < seq.length) {
console.log( seq.substring(seqi, seqi+lenOut) );
seqi += lenOut;
} else {
var s = seq.substring(seqi);
seqi = lenOut - s.length;
console.log( s + seq.substring(0, seqi) );
}
n -= lenOut;
}
}
function fastaRandom(n, table) {
var line = new Array(60);
makeCumulative(table);
while (n>0) {
if (n<line.length) line = new Array(n);
for (var i=0; i<line.length; i++) {
var r = rand(1);
for (var c in table) {
if (r < table[c]) {
line[i] = c;
break;
}
}
}
console.log( line.join('') );
n -= line.length;
}
}
var n = +process.argv[2];
console.log(">ONE Homo sapiens alu")
fastaRepeat(2*n, ALU)
console.log(">TWO IUB ambiguity codes")
fastaRandom(3*n, IUB)
console.log(">THREE Homo sapiens frequency")
fastaRandom(5*n, HomoSap)