Skip to content

Language Shootout

A user-supported site Fastest, Shortest, Simplest

Fasta

JavaScript Node #1 — Fasta

Generate DNA sequences by copying from a given sequence and by weighted random selection with a simple linear congruential generator.

Time 10,524.1 ms
CPU time 11,481.7 ms
Peak memory 1,445,224 KB
gz 820 bytes — comments removed, gzipped
Style ★★★☆☆
Implementation JavaScript — JavaScript (Node.js) 24.10.0
By sysop-
Submitted September 24, 2026

Style assessment

Clear, era-typical benchmarks-game JS: sensible function decomposition and direct wrap-around logic, but it leans on dated constructs (var everywhere, for...in over objects, per-line console.log instead of buffered process.stdout.write, new Array) and terse globals (A, C, M, last) with `last` shadowed to mean something different inside makeCumulative. Using let/const, Object.keys/entries, and chunked stdout writes would raise both idiom and naming.

// The Computer Language Benchmarks Game
// http://benchmarksgame.alioth.debian.org/
//
//  Contributed by Ian Osgood

var last = 42, A = 3877, C = 29573, M = 139968;

function rand(max) {
  last = (last * A + C) % M;
  return max * last / M;
}

var ALU =
  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";

var IUB = {
  a:0.27, c:0.12, g:0.12, t:0.27,
  B:0.02, D:0.02, H:0.02, K:0.02,
  M:0.02, N:0.02, R:0.02, S:0.02,
  V:0.02, W:0.02, Y:0.02
}

var HomoSap = {
  a: 0.3029549426680,
  c: 0.1979883004921,
  g: 0.1975473066391,
  t: 0.3015094502008
}

function makeCumulative(table) {
  var last = null;
  for (var c in table) {
    if (last) table[c] += table[last];
    last = c;
  }
}

function fastaRepeat(n, seq) {
  var seqi = 0, lenOut = 60;
  while (n>0) {
    if (n<lenOut) lenOut = n;
    if (seqi + lenOut < seq.length) {
      console.log( seq.substring(seqi, seqi+lenOut) );
      seqi += lenOut;
    } else {
      var s = seq.substring(seqi);
      seqi = lenOut - s.length;
      console.log( s + seq.substring(0, seqi) );
    }
    n -= lenOut;
  }
}

function fastaRandom(n, table) {
  var line = new Array(60);
  makeCumulative(table);
  while (n>0) {
    if (n<line.length) line = new Array(n);
    for (var i=0; i<line.length; i++) {
      var r = rand(1);
      for (var c in table) {
        if (r < table[c]) {
          line[i] = c;
          break;
        }
      }
    }
    console.log( line.join('') );
    n -= line.length;
  }
}

var n = +process.argv[2];

console.log(">ONE Homo sapiens alu")
fastaRepeat(2*n, ALU)

console.log(">TWO IUB ambiguity codes")
fastaRandom(3*n, IUB)

console.log(">THREE Homo sapiens frequency")
fastaRandom(5*n, HomoSap)

Back to Fasta